제품 > 항체 > 단일클론항체(mAb)

ASCT2/SLC1A5 Rabbit mAb (A23156)

Datasheet

Tested applications:WBIHC-PIF/ICCIPChIPChIP-seqRIPFCFC(Intra)ELISAMeDIPNucleotide ArrayDBFACSCoIPCUT&TagmeRIPInhibitionReactivity:Human, Mouse

ABclonal:Western blot - ASCT2/SLC1A5 Rabbit mAb (A23156)

Western blot analysis of lysates from Jurkat cells, using ASCT2/SLC1A5 Rabbit mAb (A23156) at 1:1000 dilution.
Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
Lysates/proteins: 25μg per lane.
Blocking buffer: 3% nonfat dry milk in TBST.
Detection: ECL Basic Kit (RM00020).
Exposure time: 60s.

ABclonal:Western blot - ASCT2/SLC1A5 Rabbit mAb (A23156)

Western blot analysis of lysates from 293F cells, using ASCT2/SLC1A5 Rabbit mAb (A23156) at 1:1000 dilution.
Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
Lysates/proteins: 25μg per lane.
Blocking buffer: 3% nonfat dry milk in TBST.
Detection: ECL Basic Kit (RM00020).
Exposure time: 60s.

ABclonal:Immunohistochemistry - ASCT2/SLC1A5 Rabbit mAb (A23156)

Immunohistochemistry analysis of paraffin-embedded Human cervix using ASCT2/SLC1A5 Rabbit mAb (A23156) at dilution of 1:100 (40x lens). High pressure antigen retrieval performed with 0.01M Citrate Bufferr (pH 6.0) prior to IHC staining.

ABclonal:Immunohistochemistry - ASCT2/SLC1A5 Rabbit mAb (A23156)

Immunohistochemistry analysis of paraffin-embedded Human kidney using ASCT2/SLC1A5 Rabbit mAb (A23156) at dilution of 1:100 (40x lens). High pressure antigen retrieval performed with 0.01M Citrate Bufferr (pH 6.0) prior to IHC staining.

Overview

Product nameASCT2/SLC1A5 Rabbit mAb
Catalog No.A23156
Host speciesRabbit
Purification methodAffinity purification
IsotypeIgG
CloneNo.ARC59409
The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).
ImmunogenRecombinant fusion protein containing a sequence corresponding to amino acids 483-541 of human ASCT2/SLC1A5(NP_005619.1).
SequenceCAAAATTACGTGGACCGTACGGAGTCGAGAAGCACAGAGCCTGAGTTGATACAAGTGAAGAGTGAGCTGCCCCTGGATCCGCTGCCAGTCCCCACTGAGGAAGGAAACCCCCTCCTCAAACACTATCGGGGGCCCGCAGGGGATGCCACGGTCGCCTCTGAGAAGGAATCAGTCATG
Gene ID
Swiss Prot
SynonymsR16; AAAT; ATBO; M7V1; RDRC; ASCT2; M7VS1; ASCT2/SLC1A5
Calculated MW57kDa
Observed MW70-80kDa
ReactivityHuman, Mouse
Tested applicationsWBIHC-PIF/ICCIPChIPChIP-seqRIPFCFC(Intra)ELISAMeDIPNucleotide ArrayDBFACSCoIPCUT&TagmeRIPInhibition
Recommended dilution
  • WB 1:1000 - 1:2000
  • IHC-P 1:100 - 1:500
  • ELISA Recommended starting concentration is 1 μg/mL. Please optimize the concentration based on your specific assay requirements.
Storage bufferStore at -20℃. Avoid freeze / thaw cycles.
Buffer: PBS with 0.05% proclin300, 0.05% BSA, 50% glycerol, pH7.3.
Key applicationWestern blotting    Immunohistochemistry    
Positive samplesJurkat, 293F
Cellular locationCell membrane, Melanosome, Multi-pass membrane protein.
Customer validation

WB(Homo sapiens)

Documents

Certificate of Compliance

To download a Certificate of Compliance, please enter your Lot number below:

Lot number

    ABclonal:Western blot - ASCT2/SLC1A5 Rabbit mAb (A23156)}

    Western blot - ASCT2/SLC1A5 Rabbit mAb (A23156)

    Western blot analysis of lysates from Jurkat cells, using ASCT2/SLC1A5 Rabbit mAb (A23156) at 1:1000 dilution.
    Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
    Lysates/proteins: 25μg per lane.
    Blocking buffer: 3% nonfat dry milk in TBST.
    Detection: ECL Basic Kit (RM00020).
    Exposure time: 60s.
    ABclonal:Western blot - ASCT2/SLC1A5 Rabbit mAb (A23156)}

    Western blot - ASCT2/SLC1A5 Rabbit mAb (A23156)

    Western blot analysis of lysates from 293F cells, using ASCT2/SLC1A5 Rabbit mAb (A23156) at 1:1000 dilution.
    Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
    Lysates/proteins: 25μg per lane.
    Blocking buffer: 3% nonfat dry milk in TBST.
    Detection: ECL Basic Kit (RM00020).
    Exposure time: 60s.
    ABclonal:Immunohistochemistry - ASCT2/SLC1A5 Rabbit mAb (A23156)}

    Immunohistochemistry - ASCT2/SLC1A5 Rabbit mAb (A23156)

    Immunohistochemistry analysis of paraffin-embedded Human cervix using ASCT2/SLC1A5 Rabbit mAb (A23156) at dilution of 1:100 (40x lens). High pressure antigen retrieval performed with 0.01M Citrate Bufferr (pH 6.0) prior to IHC staining.
    ABclonal:Immunohistochemistry - ASCT2/SLC1A5 Rabbit mAb (A23156)}

    Immunohistochemistry - ASCT2/SLC1A5 Rabbit mAb (A23156)

    Immunohistochemistry analysis of paraffin-embedded Human kidney using ASCT2/SLC1A5 Rabbit mAb (A23156) at dilution of 1:100 (40x lens). High pressure antigen retrieval performed with 0.01M Citrate Bufferr (pH 6.0) prior to IHC staining.

    * For research use only. Not for therapeutic or diagnostic purposes.

    Publishing research using A23156? Please let us know so that we can cite the reference in this datasheet.