제품 > 항체 > 단일클론항체(mAb)

ASCT2/SLC1A5 Rabbit mAb (A23156)

Tested applications:WB IHC-P IF/ICC IP ChIP ChIP-seq RIP FC FC(Intra)ELISA MeDIP Nucleotide Array DB FACS CoIP CUT&Tag meRIP InhibitionReactivity:Human, Mouse

Western blot analysis of lysates from Jurkat cells, using ASCT2/SLC1A5 Rabbit mAb (A23156) at 1:1000 dilution.
Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
Lysates/proteins: 25μg per lane.
Blocking buffer: 3% nonfat dry milk in TBST.
Detection: ECL Basic Kit (RM00020).
Exposure time: 60s.

Western blot analysis of lysates from 293F cells, using ASCT2/SLC1A5 Rabbit mAb (A23156) at 1:1000 dilution.
Secondary antibody: HRP-conjugated Goat anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
Lysates/proteins: 25μg per lane.
Blocking buffer: 3% nonfat dry milk in TBST.
Detection: ECL Basic Kit (RM00020).
Exposure time: 60s.

ABclonal:Immunohistochemistry - ASCT2/SLC1A5 Rabbit mAb (A23156)

Immunohistochemistry analysis of paraffin-embedded Human cervix using ASCT2/SLC1A5 Rabbit mAb (A23156) at dilution of 1:100 (40x lens). High pressure antigen retrieval performed with 0.01M Citrate Bufferr (pH 6.0) prior to IHC staining.

Immunohistochemistry analysis of paraffin-embedded Human kidney using ASCT2/SLC1A5 Rabbit mAb (A23156) at dilution of 1:100 (40x lens). High pressure antigen retrieval performed with 0.01M Citrate Bufferr (pH 6.0) prior to IHC staining.

Overview

Product name	ASCT2/SLC1A5 Rabbit mAb
Catalog No.	A23156
Host species	Rabbit
Purification method	Affinity purification
Isotype	IgG
CloneNo.	ARC59409

Background

The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).

Immunogen information

Immunogen	Recombinant fusion protein containing a sequence corresponding to amino acids 483-541 of human ASCT2/SLC1A5(NP_005619.1).
Sequence	CAAAATTACGTGGACCGTACGGAGTCGAGAAGCACAGAGCCTGAGTTGATACAAGTGAAGAGTGAGCTGCCCCTGGATCCGCTGCCAGTCCCCACTGAGGAAGGAAACCCCCTCCTCAAACACTATCGGGGGCCCGCAGGGGATGCCACGGTCGCCTCTGAGAAGGAATCAGTCATG
Gene ID
Swiss Prot
Synonyms	R16; AAAT; ATBO; M7V1; RDRC; ASCT2; M7VS1; ASCT2/SLC1A5
Calculated MW	57kDa
Observed MW	70-80kDa

Applications

Reactivity	Human, Mouse
Tested applications	WB IHC-P IF/ICC IP ChIP ChIP-seq RIP FC FC(Intra)ELISA MeDIP Nucleotide Array DB FACS CoIP CUT&Tag meRIP Inhibition
Recommended dilution	WB 1:1000 - 1:2000 IHC-P 1:100 - 1:500 ELISA Recommended starting concentration is 1 μg/mL. Please optimize the concentration based on your specific assay requirements.
Storage buffer	Store at -20℃. Avoid freeze / thaw cycles. Buffer: PBS with 0.05% proclin300, 0.05% BSA, 50% glycerol, pH7.3.
Key application	Western blotting Immunohistochemistry
Positive samples	Jurkat, 293F
Cellular location	Cell membrane, Melanosome, Multi-pass membrane protein.