제품 > 항체 > 단일클론항체(mAb)

FGFR1 Rabbit mAb (A23390)

Datasheet

Tested applications:WBIHC-PIF/ICCIPChIPChIP-seqRIPFCFC(Intra)ELISAMeDIPNucleotide ArrayDBFACSCoIPCUT&TagmeRIPInhibitionReactivity:Human, Mouse, Rat

ABclonal:Western blot - FGFR1 Rabbit mAb (A23390)

Western blot analysis of various lysates, using FGFR1 Rabbit mAb (A23390) at 1:3600 dilution.Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.Lysates/proteins: 25ug per lane.Blocking buffer: 3% nonfat dry milk in TBST.Detection: ECL Basic Kit (RM00020).Exposure time: 10s.

ABclonal:Western blot - FGFR1 Rabbit mAb (A23390)

Western blot analysis of lysates from U-251MG cells, using FGFR1 Rabbit mAb (A23390) at 1:3600 dilution.
Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
Lysates/proteins: 25μg per lane.
Blocking buffer: 3% nonfat dry milk in TBST.
Detection: ECL Basic Kit (RM00020).
Exposure time: 10s.

Overview

Product nameFGFR1 Rabbit mAb
Catalog No.A23390
Host speciesRabbit
Purification methodAffinity purification
IsotypeIgG
CloneNo.ARC53422
The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized.
ImmunogenRecombinant fusion protein containing a sequence corresponding to amino acids 38-123 of human FGFR1 (NP_075598.2).
SequenceGTGGAAGTGGAGTCCTTCCTGGTCCACCCCGGTGACCTGCTGCAGCTTCGCTGTCGGCTGCGGGACGATGTGCAGAGCATCAACTGGCTGCGGGACGGGGTGCAGCTGGCGGAAAGCAACCGCACCCGCATCACAGGGGAGGAGGTGGAGGTGCAGGACTCCGTGCCCGCAGACTCCGGCCTCTATGCTTGCGTAACCAGCAGCCCCTCGGGCAGTGACACCACCTACTTCTCCGTCAATGTTTCAGATGCTCTCCCC
Gene ID
Swiss Prot
SynonymsCEK; FLG; HH2; OGD; ECCL; FLT2; KAL2; BFGFR; CD331; FGFBR; FLT-2; HBGFR; N-SAM; FGFR-1; HRTFDS; bFGF-R-1; FGFR1
Calculated MW92kDa
Observed MW122kDa
ReactivityHuman, Mouse, Rat
Tested applicationsWBIHC-PIF/ICCIPChIPChIP-seqRIPFCFC(Intra)ELISAMeDIPNucleotide ArrayDBFACSCoIPCUT&TagmeRIPInhibition
Recommended dilution
  • WB 1:2000 - 1:4000
Storage bufferStore at -20℃. Avoid freeze / thaw cycles.
Buffer: PBS with 0.05% proclin300, 0.05% BSA, 50% glycerol, pH7.3.
Key applicationWestern blotting    
Positive samplesU-251MG, Mouse brain, Rat brain
Cellular locationCell membrane, Cytoplasm, Cytoplasmic vesicle, Nucleus, Single-pass type I membrane protein, cytosol

Documents

Certificate of Compliance

To download a Certificate of Compliance, please enter your Lot number below:

Lot number

ABclonal:Western blot - FGFR1 Rabbit mAb (A23390)}

Western blot - FGFR1 Rabbit mAb (A23390)

Western blot analysis of various lysates, using FGFR1 Rabbit mAb (A23390) at 1:3600 dilution.Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.Lysates/proteins: 25ug per lane.Blocking buffer: 3% nonfat dry milk in TBST.Detection: ECL Basic Kit (RM00020).Exposure time: 10s.
ABclonal:Western blot - FGFR1 Rabbit mAb (A23390)}

Western blot - FGFR1 Rabbit mAb (A23390)

Western blot analysis of lysates from U-251MG cells, using FGFR1 Rabbit mAb (A23390) at 1:3600 dilution.
Secondary antibody: HRP Goat Anti-Rabbit IgG (H+L) (AS014) at 1:10000 dilution.
Lysates/proteins: 25μg per lane.
Blocking buffer: 3% nonfat dry milk in TBST.
Detection: ECL Basic Kit (RM00020).
Exposure time: 10s.

* For research use only. Not for therapeutic or diagnostic purposes.

항체 (4)

ELISA 키트 (1)

재조합 단백질 (1)

Secondary Antibodies (24)